Tau ASO-12 (murine) (sodium)

• CAT Number: I041016
• Molecular Weight: 7619.00
• Purity: ≥95%

TauASO-12 (murine) (sodium) is a Tau-lowering antisense oligonucleotide (ASO) for murine use, and it has the potential for the research of Alzheimer Disease. (TauASO-12 sequence – 5′ GCTTTTACTGACCATGCGAG 3′ [1])

Reference

[1]. DeVos SL, Miller RL, Schoch KM, et al. Tau reduction prevents neuronal loss and reverses pathological tau deposition and seeding in mice with tauopathy. Sci Transl Med. 2017;9(374):eaag0481.
 [Content Brief]